View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14654_low_9 (Length: 290)
Name: NF14654_low_9
Description: NF14654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14654_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 277
Target Start/End: Original strand, 39611822 - 39612083
Alignment:
| Q |
16 |
atatatatgttcatgtgatataatagcaacttcactaggccagagcctatttctaaaaatataatgtgtcaaattaaattcatttaaaatgttgcaaatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39611822 |
atatatatgttcatgtgatataatagcaacttcactaggccagagcctatttctaaaaatataatgtgtcaaattaaattcatttaaaatgatgcaaatt |
39611921 |
T |
 |
| Q |
116 |
taatcatgttaatattgagtttgtgaaatatagtattaatcatcgtttgattttaaaatacactagtaagccacaatgaaaatgtaaaacaaaaacattt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39611922 |
taatcatgttaatattgagtttgtgaaatatagtattaatcatcttttgattttaaaatacactagtaagccacaatgaaaatgtaaaacaaaaacattt |
39612021 |
T |
 |
| Q |
216 |
gtgtgaagcaaatttttgctgatttggctagagtcgcgactcttgagccggttgtttcttct |
277 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
39612022 |
gtatgaagcaaatttttgctgatttggctagagttgcgactcttgggccggttgtttcttct |
39612083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University