View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14655_high_12 (Length: 227)
Name: NF14655_high_12
Description: NF14655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14655_high_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 36 - 227
Target Start/End: Original strand, 48047223 - 48047409
Alignment:
| Q |
36 |
atagatagatagatactacaagagtaaactagattttgcagttattgtaatcgtatttttattgaactccaaacatgcaacacggtaacatatgcatgca |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
48047223 |
atagatagatagatactacaagagtaaactagattttgcagttattgtactcgtattttc-ttgaactccaaacatgcaacacggtaacatatgc----a |
48047317 |
T |
 |
| Q |
136 |
tgcatgtagttagtatatcacaattcacaactctcaatttgaagattacacgatgatgaggttggttatcagtcttctccaatttcattttc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48047318 |
tgcatgtagttagtatatcacaattcacaactctcaatttgaagattacacgatgatgaggttggttatcagtcttctccaatttcattttc |
48047409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University