View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14655_low_14 (Length: 252)
Name: NF14655_low_14
Description: NF14655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14655_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 41930025 - 41929789
Alignment:
| Q |
1 |
gaccgaaagtctttaaggcctttataacaaaatctatacattaatataatactatactataacaagtgggattctttattgaaggcactcaatcgggttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41930025 |
gaccgaaagtctttaaggcctttataacaaaatctatacattaatataatactatactataacaagtgggattctttattgaaggcactcaatcgggttc |
41929926 |
T |
|
| Q |
101 |
ttgacttcatcatccttcatttataagatgaagtctttaagcctctctctaaactatcctatgatgtctgttgaaacaatgacaaaattgtatgcagtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
41929925 |
ttgacttcatcatccttcatttataagatgaagtctttaagcctctctctaaactatcctatgatgtcagttgaaacaatgacaaaattatatgcagtgg |
41929826 |
T |
|
| Q |
201 |
attcccttccgttgaatgggaccgaaatctagatctt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41929825 |
attcccttccgttgaatgggaccgaaatctagatctt |
41929789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 43
Target Start/End: Original strand, 43756827 - 43756862
Alignment:
| Q |
8 |
agtctttaaggcctttataacaaaatctatacatta |
43 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43756827 |
agtctttaaggactttataacaaaatctatacatta |
43756862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University