View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14655_low_18 (Length: 215)
Name: NF14655_low_18
Description: NF14655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14655_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 13 - 176
Target Start/End: Complemental strand, 1153415 - 1153252
Alignment:
| Q |
13 |
atatgaatcagacacttgcaattcagttaggttggaaattgaaaacggaaagattccagttaataggttatcttcgacatagaatccttcaaccgcttca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1153415 |
atatgaatcagacacttgcaattcagttaggttggaaattgaaaacggaaagattccagttaataggttatcttcgacatagaatccttcaaccgcttca |
1153316 |
T |
|
| Q |
113 |
aacaaccagcttgttttggaatttcaccatgcaagccgatatttgaaagcttgagtattgttag |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1153315 |
aacaaccagcttgttttggaatttcaccatgcaagccgatatttgaaagcttgagtattgttag |
1153252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 102 - 147
Target Start/End: Complemental strand, 35752928 - 35752883
Alignment:
| Q |
102 |
caaccgcttcaaacaaccagcttgttttggaatttcaccatgcaag |
147 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
35752928 |
caaccgcttcaaacaaccaacttgttttggaacttcaccatgcaag |
35752883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 161
Target Start/End: Complemental strand, 35364968 - 35364912
Alignment:
| Q |
105 |
ccgcttcaaacaaccagcttgttttggaatttcaccatgcaagccgatatttgaaag |
161 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
35364968 |
ccgcttcaaacgaccaacttgttttggaatttcaccatgcaagtcgacgtttgaaag |
35364912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 106 - 147
Target Start/End: Complemental strand, 35404688 - 35404647
Alignment:
| Q |
106 |
cgcttcaaacaaccagcttgttttggaatttcaccatgcaag |
147 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
35404688 |
cgcttcaaacaaccaacttgttttggaattccaccatacaag |
35404647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 106 - 167
Target Start/End: Original strand, 10412050 - 10412111
Alignment:
| Q |
106 |
cgcttcaaacaaccagcttgttttggaatttcaccatgcaagccgatatttgaaagcttgag |
167 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||| || ||||||||| ||||| |
|
|
| T |
10412050 |
cgcttcaaacgaccaacttgttttggaatttcaccatgcaagttgacatttgaaaggttgag |
10412111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 105 - 147
Target Start/End: Original strand, 10421691 - 10421733
Alignment:
| Q |
105 |
ccgcttcaaacaaccagcttgttttggaatttcaccatgcaag |
147 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
10421691 |
ccgcttcaaacgaccaacttgttttggaatttcaccatgcaag |
10421733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University