View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14655_low_7 (Length: 310)
Name: NF14655_low_7
Description: NF14655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14655_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 36990470 - 36990774
Alignment:
| Q |
1 |
gacagcttcattacccacagagcattctgtgacgcattagctgaagagaacaacaaagccaacgaaggagtactatcaaacttgcaacaccaaccaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36990470 |
gacagcttcattacccacagagcattctgtgacgcattggctgaagagaacaacaaagccaacgaaggagtactatcaaacttgcaacaccaaccaatct |
36990569 |
T |
|
| Q |
101 |
caaatctcgtttcttcattacctttaaaccccattaataaccctcaaattggtggaactgtatcagaattcaacaaccattcagatcacaagctcccatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36990570 |
caaatctcgtttcttcattacctttaaaccccattaataaccctcaaatttgtggaactgtatcagaattcaacaaccattcagatcacaagctcccatt |
36990669 |
T |
|
| Q |
201 |
atcatcccctcatgaactcatgtc---gtctgtgccaccaaaacccttcaataacaacatattcactagaagcctttcatcatcaacttcatctccttct |
297 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36990670 |
atcatcccctcatgaactcatgtccatgtctgtgccaccaaaacccttcaataacaacatattcactagaagcctttcatcatcaacttcatctccttct |
36990769 |
T |
|
| Q |
298 |
cttca |
302 |
Q |
| |
|
||||| |
|
|
| T |
36990770 |
cttca |
36990774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 13 - 55
Target Start/End: Complemental strand, 44150184 - 44150142
Alignment:
| Q |
13 |
acccacagagcattctgtgacgcattagctgaagagaacaaca |
55 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
44150184 |
acccacagagcattctgtgatgcattaactgaagaaaacaaca |
44150142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University