View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14655_low_9 (Length: 289)
Name: NF14655_low_9
Description: NF14655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14655_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 139 - 274
Target Start/End: Original strand, 7156641 - 7156776
Alignment:
| Q |
139 |
gcatatttatttcttcatggtatcattaaccggagtctctgtaactttaggaagtagccctttttctctgcaggtttctatagctcctgtgaacatgtct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156641 |
gcatatttatttcttcatggtatcattaaccggagtctctgtaactttaggaagtagccctttttctctgcaggtttctatagctcctgtgaacatgtct |
7156740 |
T |
|
| Q |
239 |
tctaagctgtatttaaatataaaccccaagtctgtg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156741 |
tctaagctgtatttaaatataaaccccaagtctgtg |
7156776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 7156507 - 7156582
Alignment:
| Q |
19 |
ccataaacatgaatattattatgagtgacatcatataacataaaccttagttaataacatatgaaaaaggatcctt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156507 |
ccataaacatgaatattattatgagtgacatcatataacataaaccttagttaataacatatgaaaaaggatcctt |
7156582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University