View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14656_high_14 (Length: 276)
Name: NF14656_high_14
Description: NF14656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14656_high_14 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 120 - 276
Target Start/End: Complemental strand, 40148668 - 40148512
Alignment:
| Q |
120 |
ttcacttgctaatttattcatttttcatgtatggtacacaccacctggttgataaattaataaaaaacacttaaaaaggttaatgttttctttcctcatc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40148668 |
ttcacttgctaatttattcatttttcatgtatggtacacaccacctggttgataaattaataaaaaacacttaaaaaggttaatgttttctttcctcatc |
40148569 |
T |
|
| Q |
220 |
ctatctttacttttggtagcttagctacattcctctcacttcagatctacctctatt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40148568 |
ctatctttacttttggtagcttagctacattcctctcacttcagatctacctctatt |
40148512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 40148839 - 40148737
Alignment:
| Q |
18 |
atgatattctcaaaagaattgtgctatttaaagcgactaaaatcatcctgatattatctcgagtgatgatagaaatatttttagatcatttattaaagag |
117 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40148839 |
atgatattctcaaa-gaattgtggtatttaaagcgactgaaatcgtcatgatattatctcgagtgatgatagaaatatttttaaatcatttattaaagag |
40148741 |
T |
|
| Q |
118 |
gttt |
121 |
Q |
| |
|
|||| |
|
|
| T |
40148740 |
gttt |
40148737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University