View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14656_low_14 (Length: 324)
Name: NF14656_low_14
Description: NF14656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14656_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 35202426 - 35202572
Alignment:
| Q |
1 |
ggaacacttagaaacgttcctgttggtggtggttgcagaaaaaacaaacgtcttaaacgaccaaatcactcctcttcaaatattgatactgctactgctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35202426 |
ggaacacttagaaacgttcctgttggtggtggttgcagaaaaaacaaacgtcttaaacgaccaaatcactcttcttcaaatattgatactgctactgctt |
35202525 |
T |
 |
| Q |
101 |
ctccttcttcttcaactcctactagtgctaattcaaaccctccttct |
147 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35202526 |
ctccttcttcttcaactcctaatagtgctaattcaaaccctccttct |
35202572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 174 - 307
Target Start/End: Original strand, 35202593 - 35202726
Alignment:
| Q |
174 |
ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202593 |
ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg |
35202692 |
T |
 |
| Q |
274 |
ttcaattctacaagagtttcaagttcttcttctg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35202693 |
ttcaattctacaagagtttcaagttcttcttctg |
35202726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 3945890 - 3945850
Alignment:
| Q |
7 |
cttagaaacgttcctgttggtggtggttgcagaaaaaacaa |
47 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||| |||||| |
|
|
| T |
3945890 |
cttagaaatgttcctgttggtggtggttacagaagaaacaa |
3945850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 46
Target Start/End: Original strand, 24878959 - 24878995
Alignment:
| Q |
10 |
agaaacgttcctgttggtggtggttgcagaaaaaaca |
46 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
24878959 |
agaaatgttcctgttggtggtggctgcagaaaaaaca |
24878995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University