View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14656_low_16 (Length: 291)
Name: NF14656_low_16
Description: NF14656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14656_low_16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 23 - 291
Target Start/End: Complemental strand, 35202971 - 35202703
Alignment:
| Q |
23 |
tgcactcatgaatttctgttgcagtagtgtagagttaagtagagaagccataactggagtagtagaggccatggagttatcattagttgaagtagtagaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
35202971 |
tgcactcatgaatttctgttgcagtagtgtagagttaagtagagaagccataactggagtagtagaggccatggagttatcgttagttgaagtagaagaa |
35202872 |
T |
|
| Q |
123 |
gaaccaaagatggaactgtagttgttattatttgaaccaaacccatttctgtaatcatcatgatgattaagattaactaccccagatgaaaaacctaatc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202871 |
gaaccaaagatggaactgtagttgttattatttgaaccaaacccatttctgtaatcatcatgatgattaagattaactaccccagatgaaaaacctaatc |
35202772 |
T |
|
| Q |
223 |
caagaccattcacctgaggctgctgctgctgaagatgatcataaccagaagaagaacttgaaactcttg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202771 |
caagaccattcacctgaggctgctgctgctgaagatgatcataaccagaagaagaacttgaaactcttg |
35202703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University