View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14656_low_24 (Length: 219)
Name: NF14656_low_24
Description: NF14656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14656_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 29151451 - 29151267
Alignment:
| Q |
17 |
aaggaaattaaaaaaggatnnnnnnnnntgtcttaccaccaccaacttccgttgcaacaagaaacaatgagagaagtagaattatagcaaagaaaaactt |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29151451 |
aaggaaattaaaaaaggataaaaaaaaatgtcttaccaccaccaacttccgttgcaacaagaaacaatgagagaagtagaattatagcaaagaaaaactt |
29151352 |
T |
|
| Q |
117 |
gagcattttagccatacnnnnnnnncgtctttgcatgcacaaaatagaatatgattttatctttttataatgtatatagtccatg |
201 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29151351 |
gagcattttagccatacttttttttcgtctttgcatgcacaaaatagaatatgattttatctttttataatgtatatagtccatg |
29151267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University