View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14656_low_6 (Length: 489)
Name: NF14656_low_6
Description: NF14656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14656_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 7 - 476
Target Start/End: Original strand, 41641458 - 41641927
Alignment:
| Q |
7 |
gagggagatgtgaaattggatggtggaaatgtacaagaggggagttcgtctggatgtgatggtatgatggatcgcagtgatcatgggatggaatcgagga |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41641458 |
gagggtgatgtgaaattggatggtggaaatgtacaagaggggagttcgtctggatgtgatggtatgatggatcgcagtgatcatgggatggaatcgagga |
41641557 |
T |
|
| Q |
107 |
attcgtcgggttcgagtgtggttaagagcaatagaagatctagtttagatgttaaggagaaggattgggatgcatttaatgttgattcaaatggaggtgc |
206 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41641558 |
attcgtcgggttcgagtgcggataagagcaatagaagatctagtttagatgttaaggagaaggattggaatgcatttaatgttgattcaaatggaggtgc |
41641657 |
T |
|
| Q |
207 |
tgggtctgaatcttattcggannnnnnnagtgaattcggagatcaaaatgggaaaggatatgatcatgatttgaatgctgaggtgaaacatgctaatgaa |
306 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41641658 |
tgggtctgaatcttattcggatttttttagtgaattcggagatcaaaatgggaaaggatatgatcatgatttgaatactgaggtgaaacatgctaatgaa |
41641757 |
T |
|
| Q |
307 |
attccgggagatcaatatgcgcaaacgtataatcgtgattctaatactgaggtgaaacttggtaatgaaattccgagtgatggaatgaatgcttcggttg |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41641758 |
attccgggagatcaatatgcgcaaacgtataatcgtgattctaatactgaggtgaaacttggtaatgaaattccgagtgatggaatgaatgcttcggttg |
41641857 |
T |
|
| Q |
407 |
attatgtgcaatatcaagagggtcaaagttacgatgcatctgcgagaaatagcacaagtggggatgatgt |
476 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41641858 |
attatgtgcaatatcaagagggtcaaagttatgatgcatctgcgagaaatagcacaagtggggaggatgt |
41641927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University