View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14656_low_8 (Length: 407)
Name: NF14656_low_8
Description: NF14656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14656_low_8 |
 | |
|
| [»] scaffold0086 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 132 - 392
Target Start/End: Original strand, 18017580 - 18017838
Alignment:
| Q |
132 |
actatttcacttttagccacattctaatacattactgattttgtcaacaataaccaatatttgttattcaatcagtgccnnnnnnnnnnnnagaaaacaa |
231 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18017580 |
actatttcacttgtagccacattctaatacattactgattttttcaacaataaccaatatttgttattcaatcagtgcctatatatata--agaaaacaa |
18017677 |
T |
|
| Q |
232 |
atgtctccattctgcacgtatatgtgcatgtcctctcactcaaaacacacataacaaacacaaatataccaaacactttctaaagttttgagtttttcat |
331 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18017678 |
atgtttccattctgcacgtatatgtgcatgtcgtctcactcaaaacacacataacaaacacaaatataccaaacactttctaaggttttgagtttttcat |
18017777 |
T |
|
| Q |
332 |
gttaaaatccttcttgttgttctgtttatcctcggtttatccgagaaaggtatgtagaatt |
392 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18017778 |
gttaaaatccttcttactgttctgtttatcctcggtttatccgagaaaggtatgtagaatt |
18017838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 18017403 - 18017457
Alignment:
| Q |
1 |
aaaataattatttttcaattttcttttaaacttttgaaatatgtgaagattgttg |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18017403 |
aaaataattatttttcaattttcttttaaaattttgaaatatgtgaagattgttg |
18017457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 17 - 45
Target Start/End: Complemental strand, 37868 - 37840
Alignment:
| Q |
17 |
aattttcttttaaacttttgaaatatgtg |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37868 |
aattttcttttaaacttttgaaatatgtg |
37840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University