View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14657_low_4 (Length: 256)
Name: NF14657_low_4
Description: NF14657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14657_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 33543919 - 33544153
Alignment:
| Q |
1 |
ttttcacttattcacattaatcgtaacaagagttaatacatgtacaacttaccaatattgaatctaaataatagcttatacgagtcaaaggtccgaccaa |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
33543919 |
ttttcacttattcacattaatcgcaacaagagttaatacatgtacaacttaccaatattgaatctaaataatagcttatccgagtcgaaggtccgaccaa |
33544018 |
T |
|
| Q |
101 |
atctgccaagattcttttgaaaaaataaagtatttaaagtgcaacttttgattaaatcttggtaagttttggcaaaataaacgtgacatcttgattttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33544019 |
atctgccaagattcttttgaaaaaataaagtatttaaagtgcaacttttg-taaaattttggtaagttttggcaaaataaatgtgacatcttgattttga |
33544117 |
T |
|
| Q |
201 |
gtatcggacaatctcaccgtcaatttaaacatagtg |
236 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33544118 |
gtatcgaacaatctcaccgtcaatttaaacatagtg |
33544153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University