View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14658_high_3 (Length: 322)
Name: NF14658_high_3
Description: NF14658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14658_high_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 16 - 322
Target Start/End: Complemental strand, 43630413 - 43630096
Alignment:
| Q |
16 |
gtaatatcaaacctacgaccaccttgtggacatatatatatttatatccctccctcccttgttgcctcaacatccatcatttcgaatttgcatttggaaa |
115 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43630413 |
gtaatatcaaacctaccaccaccttgtggacatatatatatttatatccctacctcccttgttgcctcatcatccatcatttcgaatttgcatttggaaa |
43630314 |
T |
 |
| Q |
116 |
tcaaacacacaa-----ggcaataaaataatac------ataaatgggttcccttccccacgtagtagaggattgcatgggcttccttcaactctatagc |
204 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43630313 |
tcaaacacacaacacaaggcaataaaataataataatatataaatgggttcccttccccacgtagtagaggattgcatgggcttccttcaactctatagc |
43630214 |
T |
 |
| Q |
205 |
gacggttccatttaccgttccaacgacttcaaatttcaaattcccacaatagaagataactccgtaaccttcaaagactgtcttttcgacaaaaaattca |
304 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43630213 |
gacggttccatttaccgttcaaacgacttcaaatttcaaattccaacaatagaagataactccgtaaccttcaaagactgtcttttcgacaaaaaattca |
43630114 |
T |
 |
| Q |
305 |
atctctctcttcatctct |
322 |
Q |
| |
|
|||||||| ||| ||||| |
|
|
| T |
43630113 |
atctctctattcgtctct |
43630096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University