View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14658_high_7 (Length: 216)
Name: NF14658_high_7
Description: NF14658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14658_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 31 - 200
Target Start/End: Complemental strand, 8071426 - 8071255
Alignment:
| Q |
31 |
acaattgttactataaaaagaatgttacaattagggaggtcgctgatcggataataattggttttgattcattaccaaagaatttagtatattcagaccg |
130 |
Q |
| |
|
||||||||||||| |||||| ||||||| |||||||||||| ||||||||||||| ||||||||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
8071426 |
acaattgttacta-aaaaagtatgttactgttagggaggtcgttgatcggataatagttggttttggttcattagcaaagaatttagtatatttggaccg |
8071328 |
T |
 |
| Q |
131 |
gt---ggtctagcccacttacttatcttcaaactatttaaatttttcctttagactgaaatttggtggttggt |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8071327 |
gtactggtctagcccacttacttatcttcaaactatttaaatttttcctttagacggaaatttggtggttggt |
8071255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University