View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14658_low_6 (Length: 290)
Name: NF14658_low_6
Description: NF14658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14658_low_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 112 - 290
Target Start/End: Original strand, 4223604 - 4223788
Alignment:
| Q |
112 |
aatgcatattgtggggatgcatgctcatgcgtcgcagcatggacattcacatcaaaaccatggcgatggacatg------gtcattctcattcatttgga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
4223604 |
aatgcatattgtggggatgcatgctcatgcgtcgcaacatggacattcacatcaaaaccatggtgatggacatggtcatggtcattctcattcatttgga |
4223703 |
T |
|
| Q |
206 |
gagcatgatggtgtggatagtagcgtccgccatgtcgttgtttctcaggtaaccaataataaacattctctattttcttcctttt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4223704 |
gagcatgatggtgtggatagtagcgtccgccatgtcgttgtttctcaggtaaccaataataaacattctctattttcttcctttt |
4223788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 31572801 - 31572882
Alignment:
| Q |
1 |
tcttactccaataactcatgaatttgtttagagtaactcaaggtttgagttcaaaatcactggttttcgggaagggattaac |
82 |
Q |
| |
|
||||| |||||||||||||||| || ||| |||||||||||||| |||||| |||||||||||||||| |||||||||||| |
|
|
| T |
31572801 |
tcttaatccaataactcatgaagttattttgagtaactcaaggtgtgagttaaaaatcactggttttcaagaagggattaac |
31572882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University