View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14658_low_7 (Length: 278)
Name: NF14658_low_7
Description: NF14658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14658_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 41444439 - 41444269
Alignment:
| Q |
20 |
ggagagtcagtgtagtatactttgacttaagcctgctagaaagaagcttaaaactgtttatctctttctccccttattaattcttccatcttcagaactg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41444439 |
ggagagtcagtgtagtatactttgacttaagcctgctagaaagaagcttaaaactgtttatctctttctccccttattaattcttccatcttcagaactg |
41444340 |
T |
 |
| Q |
120 |
tatagt-nnnnnnnnntattcctatctctcttttgcaaatctacataattctaccaaaacaaaggcagtga |
189 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41444339 |
tatagtaaaaaaaaaatattcctatctctcttttgcaaatctacataattctaccaaaacaaaggaagtga |
41444269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 193 - 262
Target Start/End: Complemental strand, 2468178 - 2468109
Alignment:
| Q |
193 |
agcagaacctgtgcttaagtcaccgacatctccaaatataggaattgaattcaaaccagtagcaaaatca |
262 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2468178 |
agcaaaacctgtgcttaagtcaccgacatctccaaatataggaattgaattcaaaccagtagcaaaatca |
2468109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University