View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14660_high_4 (Length: 276)
Name: NF14660_high_4
Description: NF14660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14660_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 20 - 257
Target Start/End: Original strand, 26130238 - 26130475
Alignment:
| Q |
20 |
atggatagatacagaacatgcacaaataccagacatattaataatatcaatcaagtataattaaaaaatactaagcctccaattacagatattaaacatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26130238 |
atggatagatacagaacatgcacaaataccagacatattaataatatcaatcaagtataattaaaaaatactaagcctccaattacagatattaaacatt |
26130337 |
T |
 |
| Q |
120 |
cacttacataatcattctcagagttgtacgaatcctcgtgttcttgaatttcatcttcagttgtcattggagattgtgtctgcccaacattgatgtgact |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26130338 |
cacttacataatcattctcagagttgtacgaatcctcgtgttcctgaatttcatcttcagttgaaattggagattgtgtctgcccaacattgatgtgact |
26130437 |
T |
 |
| Q |
220 |
gatgcaagcaaacttggaccaccttggcataaccaagc |
257 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26130438 |
gatgcaagcaaacttggaccacctaggcataaccaagc |
26130475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University