View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14661_high_5 (Length: 229)
Name: NF14661_high_5
Description: NF14661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14661_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 126 - 209
Target Start/End: Original strand, 43601446 - 43601529
Alignment:
| Q |
126 |
taataaaatttgcggttacaaaaaacattttatcaagaatttgagttgttttagaaaataaattgtattatgagcttaactagt |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43601446 |
taataaaatttgcggtttcaaaaaacattttatcaagaatttgagtttttttagaaaataaattgtattatgagcttaactagt |
43601529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 12 - 89
Target Start/End: Original strand, 43601369 - 43601446
Alignment:
| Q |
12 |
agaagcaaaggaatataaatatgacataatggttaatgtgaatgagttaaggagtggagttataaagagacccgaggt |
89 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43601369 |
agaaacaaaggaatataaatatgacataatggttaatgtgaatgagttaaggagtggagttataaagagacccgaggt |
43601446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University