View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14661_low_3 (Length: 306)
Name: NF14661_low_3
Description: NF14661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14661_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 129 - 303
Target Start/End: Complemental strand, 5846727 - 5846553
Alignment:
| Q |
129 |
tgtattagagtattattagatgatttgaaccagtgagtgaagctagctaaagattgtggctgatagatatcataagaaaaagactcgtacattttttcca |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5846727 |
tgtattagagtattattagatgatttgaaccagtgagtgaagctagctaaagattgtggctgatagatatcataagaaatagactcgtacattttttcca |
5846628 |
T |
|
| Q |
229 |
aatcaaaagagaagatggataattaaggggacccaaaagtttacgatagatattaaaagatttgtagtattatat |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5846627 |
aatcaaaagagaagatggataattaaggggacccaaaagtttacgatagatattaaaagatttgtagtagtatat |
5846553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 62
Target Start/End: Complemental strand, 5846826 - 5846794
Alignment:
| Q |
30 |
aaagctactcaaggattggcaccccatttgacc |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5846826 |
aaagctactcaaggattggcaccccatttgacc |
5846794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University