View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14662_high_6 (Length: 242)
Name: NF14662_high_6
Description: NF14662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14662_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 225
Target Start/End: Complemental strand, 2812525 - 2812315
Alignment:
| Q |
15 |
cataggcacatattggagaccttttatttgggtgtgttgcttcaagaagattgactattgtagggacatttctaggggcatgaatgcaaaccagcaccct |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2812525 |
cataagcacatattggagaccttttatttgggtgtgttgcttcaagaagattgactattgtagggacatttctaggggcatgaatgcaaaccagcaccct |
2812426 |
T |
 |
| Q |
115 |
taactcagcatcaactcttgaactttgcactgttctttttctgtagggtatgagtcttttccttggcctatagattaatgccacaataggtgaaattatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2812425 |
taactcagcatcaactcttgaactttgcactgttctttttctgtagggtatgagtcttttccttggcctatagattaatgccacaatcggtgaaattatt |
2812326 |
T |
 |
| Q |
215 |
gctgtcattat |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
2812325 |
gctgtcattat |
2812315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University