View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14662_low_12 (Length: 215)
Name: NF14662_low_12
Description: NF14662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14662_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 70 - 201
Target Start/End: Original strand, 3920685 - 3920816
Alignment:
| Q |
70 |
acacatcaccttcactacttgaaagttattgatggtgcaaaataatatgacccacatacgttttgaaaatttcatgagattaactctcatgaacatcaat |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3920685 |
acacatcaccttcactacttgaaagttattgatggtgcaaaataatatgacccacatacgttttgaacatttcatgagattaactctcatgaacatcaat |
3920784 |
T |
 |
| Q |
170 |
ccatatctctcacaacactcagtctaaaatct |
201 |
Q |
| |
|
| ||||||||||||||||||| |||||||||| |
|
|
| T |
3920785 |
ctatatctctcacaacactcaatctaaaatct |
3920816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 3920596 - 3920662
Alignment:
| Q |
17 |
aatattaataaaagtgactatatcaaacaagatctaaattataattagcatacacacatcaccttca |
83 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3920596 |
aatattgataaaagtgactatatcaaacaagatctaaattataattagcatacacacatcaccttca |
3920662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University