View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14663_high_14 (Length: 296)
Name: NF14663_high_14
Description: NF14663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14663_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 10501015 - 10501296
Alignment:
| Q |
1 |
taatgagggtatagtggaagccgacaacatggtggaggaggttaaggtgttgtcctggcgttggggctatggaacggataaaaattcagccgtgtttctt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10501015 |
taatgagggtatagtggaagtcgacagcatggtggaggaggttaaggtgttgtcctggcgttggggctatggaacggatgaaaattcagccgtgtttctt |
10501114 |
T |
 |
| Q |
101 |
ttatgaacggtgttggaatccgatgttttgtatggtgagatagcctctgcccgagccg-ggtgaagagggggtttttggttatttcttggtctgaccagg |
199 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10501115 |
ttatgaacggtgttggaatccgaggtttcgtatggtgagatagcctctgcccgagccgcagtgaagagggggtttttggttatttctcggtctgaccagg |
10501214 |
T |
 |
| Q |
200 |
ttt---ttgttgcgggatttgcggacctgtctgttactgtgttgttgtttttgagctgttgcaggtctggtgcggtagcagt |
278 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10501215 |
tttttgttgttgcgggatttgcggacctgtctgttactgtgttgttgtttttgagctgttgcaggtctggtgcggcagcagt |
10501296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University