View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14663_high_18 (Length: 268)
Name: NF14663_high_18
Description: NF14663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14663_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 7 - 254
Target Start/End: Complemental strand, 44543227 - 44542980
Alignment:
| Q |
7 |
gaacaaatgatgggcaatattcaaacacgtgtctcccattcttaacatgtgggaagctggtgaaggttccaagtgatgaatccgaacaaaacgaagaagc |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44543227 |
gaacaaatcatgggcaatattcaaacacgtgtctcccattcttaacatgtgggaagctggtgaaggttccaagtgatgaatccgaacaaaacgaagaagc |
44543128 |
T |
 |
| Q |
107 |
ccgattctgtctcactctgcatgcatgatatcactccttctattatatttgtaagataataaataaacttcatctcttggctttgcttcaattgacaaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44543127 |
ccgattctgtctcactctgcatgcatgatatcactccttctattatatttgtaagataataaataaacttcatctcttggctttgcttcaattgacaaag |
44543028 |
T |
 |
| Q |
207 |
gatgatggaggatgaaaagacaacaaacaaacatggaaagaagaaaat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44543027 |
gatgatggaggatgaaaagacaacaaacaaacatggaaagaagaaaat |
44542980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University