View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14663_high_22 (Length: 231)
Name: NF14663_high_22
Description: NF14663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14663_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 2930428 - 2930625
Alignment:
| Q |
18 |
atcacatgatagtaatacactatgtcaatccttcctaaatctcacattagttgcaactaatctcaccggcaaacacctcctcctcgccggaaaactccct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930428 |
atcacatgatagtaatacactatgtcaatccttcctaaatctcacattagttgcaactaatctcaccggcaaacacctcctcctcgccggaaaactccct |
2930527 |
T |
|
| Q |
118 |
gcgcttcgtcggagaaatatcaatttcaatcatattctcttcctcatactgaaatcccaaagccttcctcttaaaaccatcaagagctatctcaatta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930528 |
gcgcttcgtcggagaaatatcaatttcaatcatattctcttcctcatactgaaatcccaaagccttcctcttaaaaccatcaagagctatctcaatta |
2930625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 171
Target Start/End: Complemental strand, 36117626 - 36117578
Alignment:
| Q |
123 |
tcgtcggagaaatatcaatttcaatcatattctcttcctcatactgaaa |
171 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||| || |||||||| |
|
|
| T |
36117626 |
tcgtcggagaaatatcaatctcaatcaaattctcttcttcgtactgaaa |
36117578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University