View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14663_low_21 (Length: 269)
Name: NF14663_low_21
Description: NF14663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14663_low_21 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 57 - 269
Target Start/End: Original strand, 35958278 - 35958478
Alignment:
| Q |
57 |
ctttaagacgcaaacgcaatgaggaacgcataaaggtacctacccttttcttaaagattcaannnnnnnatagcttatttgttcagtatgtttgatttac |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| || ||| | |||| |
|
|
| T |
35958278 |
ctttaagacgcaaacgcaatgaggaacgcataaaggtacctacccttttcttaaagattcaa------------tttttttttttttatagcttatttgt |
35958365 |
T |
 |
| Q |
157 |
ttatgtattttattgcagaggaaattggaaagagaacttgcttatgggggtgtgccaccaactgatgacactgaaactggtgaaattgatgacaaccaag |
256 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35958366 |
tcatgtattttattgcagaggaaattggaaagagaacttgcttatgggggtgtgccaccaactgatgacactgaaactggtgaaattgatgacaaccaag |
35958465 |
T |
 |
| Q |
257 |
aagaagaaactga |
269 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35958466 |
aagaagaaactga |
35958478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University