View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14663_low_26 (Length: 236)
Name: NF14663_low_26
Description: NF14663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14663_low_26 |
 | |
|
| [»] scaffold0638 (1 HSPs) |
| | |
|
| [»] scaffold0451 (1 HSPs) |
| | |
|
| [»] scaffold0022 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 38263072 - 38263238
Alignment:
| Q |
19 |
gagagatatgaagaaagcaatatagatgttagaggacgtgattttcagctcataccatttgggtctggtagaaggggttgtcctggattgcaattaggcc |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38263072 |
gagagatttgaagaaagcaatatagatgttagaggacgtgattttcagctcataccatttgggtctggtagaaggggttgtcctggattgcaattaggcc |
38263171 |
T |
|
| Q |
119 |
taactgtgattcgtttggtggtggctcaacttgtgcattgctttgattggaaattgcctaatcatat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38263172 |
taactgtgattcgtttggtggtggctcaacttgtgcattgctttgattggaaattgcctaatcatat |
38263238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 27 - 185
Target Start/End: Original strand, 38260109 - 38260267
Alignment:
| Q |
27 |
tgaagaaagcaatatagatgttagaggacgtgattttcagctcataccatttgggtctggtagaaggggttgtcctggattgcaattaggcctaactgtg |
126 |
Q |
| |
|
||||| || |||||||||||||| |||||||||||||||||||||||||||||| || |||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
38260109 |
tgaaggaaacaatatagatgttaaaggacgtgattttcagctcataccatttggctcaggtagaagaggttgtcctggattacaattaggtctaactgtg |
38260208 |
T |
|
| Q |
127 |
attcgtttggtggtggctcaacttgtgcattgctttgattggaaattgcctaatcatat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38260209 |
attcgtttggtggtggctcaacttgtgcattgctttgattggaaattgcctaatcatat |
38260267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0638 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: scaffold0638
Description:
Target: scaffold0638; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 6893 - 7059
Alignment:
| Q |
19 |
gagagatatgaagaaagcaatatagatgttagaggacgtgattttcagctcataccatttgggtctggtagaaggggttgtcctggattgcaattaggcc |
118 |
Q |
| |
|
||||||| ||||| || ||| ||||||||| |||||| ||||||||| || ||||||||| | ||||| |||||||| ||||||||||||||||| || | |
|
|
| T |
6893 |
gagagatttgaaggaaacaacatagatgttggaggacatgattttcaacttataccatttagctctggaagaaggggatgtcctggattgcaattgggtc |
6992 |
T |
|
| Q |
119 |
taactgtgattcgtttggtggtggctcaacttgtgcattgctttgattggaaattgcctaatcatat |
185 |
Q |
| |
|
||||| || | ||||||||||| || |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6993 |
taactatggtgcgtttggtggtagcccaacttgtgcattgctttgattttaaattgcctaatcatat |
7059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 27413448 - 27413614
Alignment:
| Q |
19 |
gagagatatgaagaaagcaatatagatgttagaggacgtgattttcagctcataccatttgggtctggtagaaggggttgtcctggattgcaattaggcc |
118 |
Q |
| |
|
||||||| ||||| || ||| ||||||||| |||||| ||| |||||||| ||||||||||| ||||| ||||||||||||||||||||||| || || | |
|
|
| T |
27413448 |
gagagatttgaaggaaacaacatagatgttggaggacatgactttcagcttataccatttggctctggaagaaggggttgtcctggattgcatttgggtc |
27413547 |
T |
|
| Q |
119 |
taactgtgattcgtttggtggtggctcaacttgtgcattgctttgattggaaattgcctaatcatat |
185 |
Q |
| |
|
||||| || | |||||||||||||| ||| |||||||||||||||||| |||||| |||||| |||| |
|
|
| T |
27413548 |
taactatggtgcgtttggtggtggcccaaattgtgcattgctttgatttgaaattacctaatgatat |
27413614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0451 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: scaffold0451
Description:
Target: scaffold0451; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 6988 - 6822
Alignment:
| Q |
19 |
gagagatatgaagaaagcaatatagatgttagaggacgtgattttcagctcataccatttgggtctggtagaaggggttgtcctggattgcaattaggcc |
118 |
Q |
| |
|
||||||| ||||| || ||| ||||||||| |||| | | ||||| || ||||||||||| ||||| |||||||| |||||||||||||||||||| | |
|
|
| T |
6988 |
gagagatttgaaggaaacaacatagatgttggagggcaacactttcatcttataccatttggctctggaagaaggggatgtcctggattgcaattaggtc |
6889 |
T |
|
| Q |
119 |
taactgtgattcgtttggtggtggctcaacttgtgcattgctttgattggaaattgcctaatcatat |
185 |
Q |
| |
|
||||| || | ||||||| ||| || |||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
6888 |
taactatggtgcgtttggcggtagcccaacttgtgcattgctttgattttaaattgcctaatgatat |
6822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Complemental strand, 91238 - 91184
Alignment:
| Q |
51 |
aggacgtgattttcagctcataccatttgggtctggtagaaggggttgtcctgga |
105 |
Q |
| |
|
||||| |||||||||| | ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
91238 |
aggacatgattttcagttgataccttttggtgctggtagaaggggttgtcctgga |
91184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University