View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14664_high_16 (Length: 403)
Name: NF14664_high_16
Description: NF14664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14664_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 1 - 392
Target Start/End: Complemental strand, 3668359 - 3667968
Alignment:
| Q |
1 |
tggtgaacaagggtaattgtggaaattggaattgatttgtttttgtggggttgtgtggaactggctatgttctgcttgattcttttgcatat-ggtgtga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
3668359 |
tggtgaacaagggtaattgtggaaattggaattgatttgtttttgtggggttgtgtggaactggctatgttctgcttgattcttttgcattttggtgtga |
3668260 |
T |
 |
| Q |
100 |
aactaaaaatgaggtgaaaagtttatgcttgtttagattggattggtttatatgttttgaaataataataacaagcatgtgtcttgcttaataattgtat |
199 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3668259 |
aactaaagatgaggtgaaaagtttatgcttgttaa-attggattggtttatatgttttgaaataataacaacaagcatgtgtcttgcttaataattgtat |
3668161 |
T |
 |
| Q |
200 |
attgttttgtttgttttataatgatatggatttaatttgtatacacaatataatatagtatgcattgagagagtttttcattcagtattcatattgattt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
3668160 |
attgttttgtttgttttataatgatatggatttaatttgtatacacaatataatatagtatgcattgagagagtttttcgttcagtattcattctgattt |
3668061 |
T |
 |
| Q |
300 |
tagtgtttatctcattctagaagattgtattttgtgggtttggatatttgctgaatatgatggtggtgaacaatggtaatcttagaattgatg |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3668060 |
tagtgtttatctcattctagaagattgtattttgttggtttggatatttgctgaatatgatggtggtgaacaatggtaatcttagaattgatg |
3667968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University