View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14664_high_23 (Length: 303)
Name: NF14664_high_23
Description: NF14664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14664_high_23 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 121 - 303
Target Start/End: Complemental strand, 34694916 - 34694734
Alignment:
| Q |
121 |
gaattgggagaggaattgttttgaggtagtgatgtcacaaacgaaaaggacataataataagacgagatgaggtttgttctgaacaaaaacatacacttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34694916 |
gaattgggagaggaattgttttgaggtagtgatgtcccaaaccaaaaggacataataataagacgagatgaggtttgttctgaacaaaaacatacacttt |
34694817 |
T |
|
| Q |
221 |
gatcaaactaattagctttgccttgtgaaattttggaagtttataattgatatgaagatgcataggtaggtgaaacctcaaca |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34694816 |
gatcaaactaattagctttgccttgtgaaattttggaagtttataattgatatgaagatgcataggtaggtgaaacctcaaca |
34694734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 154
Target Start/End: Original strand, 34825512 - 34825557
Alignment:
| Q |
109 |
gatgttagataggaattgggagaggaattgttttgaggtagtgatg |
154 |
Q |
| |
|
||||||||||| | ||||||||| |||||||||||||| ||||||| |
|
|
| T |
34825512 |
gatgttagataaggattgggagaagaattgttttgaggaagtgatg |
34825557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 3903174 - 3903244
Alignment:
| Q |
8 |
gagagagaagaatagcaaaggtgattatgtttcagtaattgagatgatctttgttgcgttaaaggagatgg |
78 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3903174 |
gagagacaagaatagcaaaggtgattatgtttccgtaattgagatgatctttgttgcgttaaaggagatgg |
3903244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 24719552 - 24719482
Alignment:
| Q |
8 |
gagagagaagaatagcaaaggtgattatgtttcagtaattgagatgatctttgttgcgttaaaggagatgg |
78 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24719552 |
gagagacaagaatagcaaaggtgattatgtttcggtaattgagatgatctttgttgcgttaaaggagatgg |
24719482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University