View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14664_high_29 (Length: 268)
Name: NF14664_high_29
Description: NF14664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14664_high_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 19166701 - 19166879
Alignment:
| Q |
18 |
ggaacaacctgagaactttgtactgactggttcagagggcaatttgattaataagggggtgattgagtaccagtttgctgaagaagacagagattgggcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19166701 |
ggaacaacctgagaactttgtactgactggttcagagggcaatttgattaataagggggtgattgagtaccagtttgctgaagaagacagagattgggcc |
19166800 |
T |
|
| Q |
118 |
ggttcaggtttggtggcaacggttagcacgaggaaacgttggtatcaatacagcaacgtgtggaggatgcggggtttgatac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19166801 |
ggttcaggtttggtggcaacggttagcacgaggaaacgttggtatcaata---caacgtgtggaggatgcggggtttgatac |
19166879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 179 - 249
Target Start/End: Original strand, 19166899 - 19166969
Alignment:
| Q |
179 |
ggaggatgcggggtttgatacgttgccgtgataatggtgatgttttacaagtatttaatgatgctgctgat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19166899 |
ggaggatgcggggtttgatacgttgccgtgataatggtgatgttttacaagtttttaatgatgctgctgat |
19166969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University