View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14664_high_48 (Length: 214)

Name: NF14664_high_48
Description: NF14664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14664_high_48
NF14664_high_48
[»] chr6 (3 HSPs)
chr6 (117-180)||(21159004-21159067)
chr6 (124-168)||(21242425-21242469)
chr6 (117-168)||(21146755-21146806)


Alignment Details
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 117 - 180
Target Start/End: Original strand, 21159004 - 21159067
Alignment:
117 tgtccatgttttctatgtcaggctagcaagcttccagaaccttaacataatcgaattgagattc 180  Q
    |||| ||||||||||||||| ||||||| | |||||||| ||||||||||||||||||||||||    
21159004 tgtcaatgttttctatgtcaagctagcatggttccagaaacttaacataatcgaattgagattc 21159067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 124 - 168
Target Start/End: Complemental strand, 21242469 - 21242425
Alignment:
124 gttttctatgtcaggctagcaagcttccagaaccttaacataatc 168  Q
    ||||| |||||||| ||||||||||||||||||||||||||||||    
21242469 gttttttatgtcagactagcaagcttccagaaccttaacataatc 21242425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 117 - 168
Target Start/End: Original strand, 21146755 - 21146806
Alignment:
117 tgtccatgttttctatgtcaggctagcaagcttccagaaccttaacataatc 168  Q
    |||| |||||||| |||||| ||||| ||||| |||||||||||||||||||    
21146755 tgtcaatgttttcaatgtcatgctagaaagctcccagaaccttaacataatc 21146806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University