View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14664_high_48 (Length: 214)
Name: NF14664_high_48
Description: NF14664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14664_high_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 117 - 180
Target Start/End: Original strand, 21159004 - 21159067
Alignment:
| Q |
117 |
tgtccatgttttctatgtcaggctagcaagcttccagaaccttaacataatcgaattgagattc |
180 |
Q |
| |
|
|||| ||||||||||||||| ||||||| | |||||||| |||||||||||||||||||||||| |
|
|
| T |
21159004 |
tgtcaatgttttctatgtcaagctagcatggttccagaaacttaacataatcgaattgagattc |
21159067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 124 - 168
Target Start/End: Complemental strand, 21242469 - 21242425
Alignment:
| Q |
124 |
gttttctatgtcaggctagcaagcttccagaaccttaacataatc |
168 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21242469 |
gttttttatgtcagactagcaagcttccagaaccttaacataatc |
21242425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 117 - 168
Target Start/End: Original strand, 21146755 - 21146806
Alignment:
| Q |
117 |
tgtccatgttttctatgtcaggctagcaagcttccagaaccttaacataatc |
168 |
Q |
| |
|
|||| |||||||| |||||| ||||| ||||| ||||||||||||||||||| |
|
|
| T |
21146755 |
tgtcaatgttttcaatgtcatgctagaaagctcccagaaccttaacataatc |
21146806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University