View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14664_low_29 (Length: 370)
Name: NF14664_low_29
Description: NF14664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14664_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 19 - 351
Target Start/End: Complemental strand, 42236599 - 42236267
Alignment:
| Q |
19 |
ttgataaacttcaaaaaccatattagaaggaagattttgttctttacgttgttgtttgttgagaatccaataagaaggaaaatgatctttgttgctattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236599 |
ttgataaacttcaaaaaccatattagaaggaagattttgttctttacgttgttgtttgttgagaatccaataagaaggaaaatgatctttgttgctattg |
42236500 |
T |
|
| Q |
119 |
ttgttgggtggtgatgattctgatttggattcataatcacgaacttttttgtaatcacgaagtaagttatcccatttatcattacattgattctggcttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236499 |
ttgttgggtggtgatgattctgatttggattcataatcacgaacttttttgtaatcacgaagtaagttatcccatttatcattacattgattctggcttc |
42236400 |
T |
|
| Q |
219 |
tcaaacaaccatggctccaacaatagttttccacccatttccatctcagttcaccactgctcttgctggtactggtgctagggcttgcaatggaggtgac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236399 |
tcaaacaaccatggctccaacaatagttttccacccatttccatctcagttcaccactgctcctgctggtactggtgctagggcttgcaatggaggtgac |
42236300 |
T |
|
| Q |
319 |
atgtgtagtgtttggtgtcctatttgggtcttg |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42236299 |
atgtgtagtgtttggtgtcctatttgggtcttg |
42236267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University