View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14664_low_40 (Length: 282)
Name: NF14664_low_40
Description: NF14664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14664_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 40337504 - 40337765
Alignment:
| Q |
1 |
acactgatcctcaacaaccctgagtctcgcccataaattctctttagccttctctcgctcttcacaacttatgctatggcggaatgcctcaattgccgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40337504 |
acactgatcctcaacaaccctgagtctcgcccataaattctctttagccttctctcgctcttcacaacttatgctatggcggaatgcctcaattgccgaa |
40337603 |
T |
 |
| Q |
101 |
atcttgaattattgatcccaatagagttgttacttgttagtttgaatcatgatggtatcattagagcatataagttttgaaaatgtcannnnnnnccctt |
200 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40337604 |
atcttgaattattgatcaaaatagag-------ttgttagtttgaatcatgatggtatcattagagcatataagttttgaaaatgtcatttttttccctt |
40337696 |
T |
 |
| Q |
201 |
tgtatcaagttggtcatttatgcataaaa--atatcaacaatattagaccaaactacttttaacctatg |
267 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40337697 |
tgtatcaagttggtcatttatgtataaaaatatatcaacaatattagaccaaactacttttaacctatg |
40337765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 7 - 105
Target Start/End: Original strand, 40342782 - 40342880
Alignment:
| Q |
7 |
atcctcaacaaccctgagtctcgcccataaattctctttagccttctctcgctcttcacaacttatgctatggcggaatgcctcaattgccgaaatctt |
105 |
Q |
| |
|
|||||||| ||| |||||| | |||||||||| ||| ||||||| ||||||||||||| ||||||||||| | |||| | ||||||||||||||||| |
|
|
| T |
40342782 |
atcctcaataactttgagtcgctcccataaattttctctagccttttctcgctcttcaccacttatgctattgaggaacggttcaattgccgaaatctt |
40342880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 40325580 - 40325702
Alignment:
| Q |
1 |
acactgatcctcaacaaccctgagtctcgcccataaattctctttagccttctctcgctcttca-caacttatgctatggcggaatgcctcaattgccga |
99 |
Q |
| |
|
|||||||||||||| ||| ||||||| | |||||||||| ||| | ||||| || ||||||||| |||||| |||||||| ||||||| ||||| |||| |
|
|
| T |
40325580 |
acactgatcctcaataactctgagtcgctcccataaattttctctggccttttcacgctcttcaccaactt-tgctatggaggaatgctgcaattaccga |
40325678 |
T |
 |
| Q |
100 |
aatcttgaattattgatcccaata |
123 |
Q |
| |
|
||||| || ||||||||| |||| |
|
|
| T |
40325679 |
aatctgtaaatattgatccaaata |
40325702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University