View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14664_low_44 (Length: 252)
Name: NF14664_low_44
Description: NF14664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14664_low_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 27792428 - 27792321
Alignment:
| Q |
135 |
ctattaatgaactgtgaccatgtcgaatcaaagtactaattagttccaactcataactactaacttagtatatatacctattttgtaatggtcattgata |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27792428 |
ctattaatgaactgtgaccatttcgaatcaaaatactaattagttccaactcataactactaacttagtatatgtacctattttgtaatggtcattgata |
27792329 |
T |
 |
| Q |
235 |
atgatatt |
242 |
Q |
| |
|
||||||| |
|
|
| T |
27792328 |
ctgatatt |
27792321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University