View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14665_high_3 (Length: 349)
Name: NF14665_high_3
Description: NF14665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14665_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 15 - 326
Target Start/End: Original strand, 9666054 - 9666365
Alignment:
| Q |
15 |
cacagaatgagtccaccgatgatgataaccaccggaaccaatcacccgcgatgaggaaaaccataaagaaaacaataatcattgatgaatcttccttaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666054 |
cacagaatgagtccaccgatgatgataaccaccggaaccaatcacccgcgatgaggaaaaccataaagaaaacaataatcattgatgaatcttccttaga |
9666153 |
T |
 |
| Q |
115 |
gaatcctgatttgggtccatttcttctgaagatggcaagagataccatagcttctggtgagaatccagaaaaggctttggattatgcaattcgggcatcc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666154 |
gaatcctgatttgggtccatttcttctgaagatggcaagagataccatagcttctggtgagaatccagaaaaggctttggattatgcaattcgggcatcc |
9666253 |
T |
 |
| Q |
215 |
aaatgttttgaacgggtttcgggtccgggtgtggatcttgctacatgtcttcatgttgttgctgcaatttattgtagtttggggaatttggatgaggcta |
314 |
Q |
| |
|
|| |||||||||||||||| ||||||||||||||||||||| || ||| | ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9666254 |
aagtgttttgaacgggttttgggtccgggtgtggatcttgccacgtgtttacatgttgttgctgcaatttattgtagtttggggaatttggatgcggcta |
9666353 |
T |
 |
| Q |
315 |
ttgaggagttgg |
326 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9666354 |
ttgaggagttgg |
9666365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University