View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14665_low_3 (Length: 349)

Name: NF14665_low_3
Description: NF14665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14665_low_3
NF14665_low_3
[»] chr8 (1 HSPs)
chr8 (15-326)||(9666054-9666365)


Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 15 - 326
Target Start/End: Original strand, 9666054 - 9666365
Alignment:
15 cacagaatgagtccaccgatgatgataaccaccggaaccaatcacccgcgatgaggaaaaccataaagaaaacaataatcattgatgaatcttccttaga 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9666054 cacagaatgagtccaccgatgatgataaccaccggaaccaatcacccgcgatgaggaaaaccataaagaaaacaataatcattgatgaatcttccttaga 9666153  T
115 gaatcctgatttgggtccatttcttctgaagatggcaagagataccatagcttctggtgagaatccagaaaaggctttggattatgcaattcgggcatcc 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9666154 gaatcctgatttgggtccatttcttctgaagatggcaagagataccatagcttctggtgagaatccagaaaaggctttggattatgcaattcgggcatcc 9666253  T
215 aaatgttttgaacgggtttcgggtccgggtgtggatcttgctacatgtcttcatgttgttgctgcaatttattgtagtttggggaatttggatgaggcta 314  Q
    || |||||||||||||||| ||||||||||||||||||||| || ||| | ||||||||||||||||||||||||||||||||||||||||||| |||||    
9666254 aagtgttttgaacgggttttgggtccgggtgtggatcttgccacgtgtttacatgttgttgctgcaatttattgtagtttggggaatttggatgcggcta 9666353  T
315 ttgaggagttgg 326  Q
    ||||||||||||    
9666354 ttgaggagttgg 9666365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University