View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14666_high_20 (Length: 206)
Name: NF14666_high_20
Description: NF14666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14666_high_20 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 206
Target Start/End: Complemental strand, 48070021 - 48069829
Alignment:
| Q |
14 |
gatgaaggttgcaacagaactgtgcannnnnnngttcaacacatcttgccttgtacttatttcaggtttctttttgtccctcactctaactactctttac |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48070021 |
gatgaaggttgcaacagaactgtgcatatttttgttcaacacatcctgccttgtacttatttcaggtttctttttgtccctcactctaactactctttac |
48069922 |
T |
 |
| Q |
114 |
tgtcccttttctctaataacttatcttttcaacacacatgcagggctccaactccaatctatgccttatgattattctgctacgactgaggca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48069921 |
tgtcccttttctctaataacttatcttttcaacacacatgcagggctccaactccaatctatgccttatgattattctgctacgactgaggca |
48069829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 48102517 - 48102324
Alignment:
| Q |
13 |
agatgaaggttgcaacagaactgtgcannnnnnngttcaacacatcttgccttgtacttatttcaggtttctttttgtccctcactctaactactcttta |
112 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48102517 |
agatgaaggttgcaacagaactgtgcatatttttgttcaacacatcctgccttgtacttatttcaggtttctttttgtccctcactctaactactcttta |
48102418 |
T |
 |
| Q |
113 |
ctgtcccttttctctaataacttatcttttcaacacacatgcagggctccaactccaatctatgccttatgattattctgctacgactgaggca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48102417 |
ctgtcccttttctctaataacttatcttttcaacacacatgcagggctccaactccaatctatgccttatgattattctgctacgaccgaggca |
48102324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University