View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14666_low_12 (Length: 355)
Name: NF14666_low_12
Description: NF14666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14666_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 354206 - 353996
Alignment:
| Q |
1 |
tccagcaatgatcacaattatggagtaatagagggaaagaataaagctaattctctactttacagttacataatgtatgaatttcacttgtctccttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
354206 |
tccagcaatgatcacaattatggagtaatagagggaaagaataaagctaattctctactttacagttacataatgtatgaatttcacttgtctccttccc |
354107 |
T |
|
| Q |
101 |
ttcaaccttcaacagatcagacataaccaactgcgggtccgagtttctgagtcttttgatcaagcttctttgttatagtggcaaacttaaccttcaaaaa |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
354106 |
ttcaaccttcaatagatcagacataaccaactgcgggtccgagtttctgagtcttctgatcaagcttctttgttatagtggcaaacttaaccttcaaaaa |
354007 |
T |
|
| Q |
201 |
caaacatcaca |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
354006 |
caaacatcaca |
353996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University