View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14666_low_14 (Length: 280)
Name: NF14666_low_14
Description: NF14666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14666_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 12 - 206
Target Start/End: Original strand, 29999729 - 29999925
Alignment:
| Q |
12 |
tttgttactcctttttgtttgtagagaaaatggaacattttagaggaatctttgctaacaatggaagtgtagtatagtagggaggaactagtaggaacat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29999729 |
tttgttactcctttttgtttgtagagaaaatggaacattttagaggaatctttgctaacaatggaagtgtagtatagtagggaggaactagtaggaacat |
29999828 |
T |
|
| Q |
112 |
agattagca-tttacttgtctatgctaatcttgttaaatttgattggatgattattaggcatttattaatactt-cataccttggtaatgtaaagtc |
206 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29999829 |
agattagcattttacttgtctatgttaatcttgttaaatttgattggatgattattaggcatttattaatacttacataccttggtaatgtaaagtc |
29999925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University