View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14667_high_6 (Length: 354)
Name: NF14667_high_6
Description: NF14667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14667_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 232 - 342
Target Start/End: Complemental strand, 23751713 - 23751603
Alignment:
| Q |
232 |
atatgatggcctttggagaaggatagagttggcttatgtgaagagatggtaatagaagtttatgatatgattagcaaggacaattttaaaattataaaat |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
23751713 |
atatgatggcctttggagaaggatagagttggcttatgtgaagagatggtaatagaagtttatgatatgattagcaaggaaaatttttaaattataaaat |
23751614 |
T |
|
| Q |
332 |
aaaatagataa |
342 |
Q |
| |
|
||||||||||| |
|
|
| T |
23751613 |
aaaatagataa |
23751603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 16 - 91
Target Start/End: Complemental strand, 23751786 - 23751711
Alignment:
| Q |
16 |
ggaataacatctttaaatatttcatccttgtttggtgtgaaagataaaagggaaggatatgaatatatcttttata |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23751786 |
ggaataacatctttaaatatttcatccttgtttggtgtgaaagataaaagggaaggatatgaatatatcttttata |
23751711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University