View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14667_high_7 (Length: 340)

Name: NF14667_high_7
Description: NF14667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14667_high_7
NF14667_high_7
[»] chr7 (2 HSPs)
chr7 (77-149)||(5523934-5524006)
chr7 (18-93)||(5523715-5523792)


Alignment Details
Target: chr7 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 77 - 149
Target Start/End: Original strand, 5523934 - 5524006
Alignment:
77 aagataagacgaaatcagtgttcttcccgtagattccaattccaaataaaatgaatctcccactcactacaac 149  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
5523934 aagataagacgaaatcagtgttcttcccgtagattccaattccaaatgaaatgaatctcccactcactacaac 5524006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 18 - 93
Target Start/End: Original strand, 5523715 - 5523792
Alignment:
18 acaaaatggtctattcaggtaaaggtttaattttgtcagatttatttaattagt--ttagtaagataagacgaaatca 93  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||| |  ||||||||||||||||||||||    
5523715 acaaaatggtctattcaggtaaaggttttattttgtcagatttatttaattactagttagtaagataagacgaaatca 5523792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University