View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14667_low_8 (Length: 340)
Name: NF14667_low_8
Description: NF14667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14667_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 77 - 149
Target Start/End: Original strand, 5523934 - 5524006
Alignment:
| Q |
77 |
aagataagacgaaatcagtgttcttcccgtagattccaattccaaataaaatgaatctcccactcactacaac |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5523934 |
aagataagacgaaatcagtgttcttcccgtagattccaattccaaatgaaatgaatctcccactcactacaac |
5524006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 18 - 93
Target Start/End: Original strand, 5523715 - 5523792
Alignment:
| Q |
18 |
acaaaatggtctattcaggtaaaggtttaattttgtcagatttatttaattagt--ttagtaagataagacgaaatca |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
5523715 |
acaaaatggtctattcaggtaaaggttttattttgtcagatttatttaattactagttagtaagataagacgaaatca |
5523792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University