View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14668_high_13 (Length: 237)
Name: NF14668_high_13
Description: NF14668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14668_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 33555381 - 33555178
Alignment:
| Q |
17 |
cataggttaattgtgttcacttcaaatgcaacaaaagaggcttctgaacgcattgcctatgaatggaactatgttgtggaaaataaatgtgagttcctct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33555381 |
cataggttaattgtgttcacttcaaatgcaacaaaagaggcttctgaacgcattgcctatgaatggaactatgttgtggaaaataaatgtgagtacctct |
33555282 |
T |
|
| Q |
117 |
tattttctgctaagatcagattatataccgtaaatgtaaatgacaatttcgatgactttgtgaaattgcagatggaaatgatggaatgggaagaggtcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33555281 |
tattttctgctaagatcagattatataccgtaaatgtaaatgacaatttcaatgactttgtgaaattgcagatggaaatgatggaatgggaagagatcat |
33555182 |
T |
|
| Q |
217 |
tgtt |
220 |
Q |
| |
|
|||| |
|
|
| T |
33555181 |
tgtt |
33555178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University