View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14668_high_15 (Length: 225)
Name: NF14668_high_15
Description: NF14668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14668_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 208
Target Start/End: Original strand, 31948660 - 31948840
Alignment:
| Q |
17 |
cagagagggtgacggcagtttgtaccggtgggaagcttgtagtgacggtgccaaagatcaaagggaactaatattcgatcttcatgcgatagaatgaata |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31948660 |
cagagagggtgacggcggtttgtaccggtgggaagcttgtagtgacggtgccaaagatcaaagggaactaatattcgatctt-----------atgaata |
31948748 |
T |
|
| Q |
117 |
tatatatgtacaccttacaccatggtatatatctcactttagaggccaaattcatcacatgactcacatatatgaatttatgacatgtatat |
208 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31948749 |
tatatatgtacaccttacaccgtggtagatatctcactttagaggccaaattcatcacatgactcacatatatgaatttatgacatgtatat |
31948840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University