View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14668_low_13 (Length: 316)
Name: NF14668_low_13
Description: NF14668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14668_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 14 - 301
Target Start/End: Original strand, 18510247 - 18510534
Alignment:
| Q |
14 |
agcaaaggcattgaaggtcagcaccagtaagagccttacagcattcagtggatggttttgctggatttggctgagtcactgatggcttgcaagcatcaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18510247 |
agcaaaggcattgaaggtcagcaccagtaagagccttacagcattcagtggatggttttgctggatatggctgagtcactgatggcttgcaagcatcaag |
18510346 |
T |
|
| Q |
114 |
tccatcttcattcatgttacatagactcatgccattggaaaatttcaacatagatgccattattactaccaccataagtagtgacaccaatttcctatgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18510347 |
tccatcttcattcatgttacatagactcatgccattggaaaattttaacatagatgccattattactaccaccataagtagtgacaccaatttcctatgt |
18510446 |
T |
|
| Q |
214 |
tctttcatcaccataattcaccaataattttgttgtatttcaataattttggtgtgaaactatgtaatggatttggtaagttatttat |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18510447 |
tctttcatcaccataattcaccaataattttgttgtacttcaataattttggtgtgaaactatgtaatggatttggtaagttatttat |
18510534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University