View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14668_low_21 (Length: 205)
Name: NF14668_low_21
Description: NF14668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14668_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 31526200 - 31526025
Alignment:
| Q |
15 |
ataatacttgacaaactcggaccttatcaattgatgcgttgtggtggtacattttgtaccatgggatttatgataacccgtagtagttgtatcataaatc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31526200 |
ataatacttgacaaactcggaccttatcagttgatgcgttgtggtggtacattttgtaccatgggatttatgataacccgtagtagttgtatcataaatc |
31526101 |
T |
|
| Q |
115 |
caagtgtcatcttttatttctaagatgtattattcatgttgcatctcaggatgccatatgagtatatgttgaatat |
190 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31526100 |
cagatgtcctcttttatttctaagatgtattattcatattacatctcaggatgccatatgagtatatgttgaatat |
31526025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 31523603 - 31523427
Alignment:
| Q |
15 |
ataatacttgacaaactcggaccttatcaattgatgcgtt-gtggtggtacattttgtaccatgggatttatgataacccgtagtagttgtatcataaat |
113 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31523603 |
ataatacttgactaactcagaccttatcaattgatgctttagtggtggtacattttgtaccatgggatttatgataacccgtagtagttgtatcataaat |
31523504 |
T |
|
| Q |
114 |
ccaagtgtcatcttttatttctaagatgtattattcatgttgcatctcaggatgccatatgagtatatgttgaatat |
190 |
Q |
| |
|
||| ||||| ||||||||||| |||||||||||||||| ||||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
31523503 |
ccaggtgtcctcttttatttccaagatgtattattcatattgcatctcgggatgccatatgattatatgatgaatat |
31523427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University