View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1466_high_12 (Length: 355)

Name: NF1466_high_12
Description: NF1466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1466_high_12
NF1466_high_12
[»] chr8 (4 HSPs)
chr8 (1-335)||(26494612-26494946)
chr8 (5-169)||(26506661-26506825)
chr8 (263-335)||(26506901-26506973)
chr8 (282-330)||(41127308-41127356)
[»] chr2 (10 HSPs)
chr2 (114-227)||(2327134-2327247)
chr2 (105-169)||(2330840-2330904)
chr2 (123-227)||(2351164-2351268)
chr2 (282-330)||(2330996-2331044)
chr2 (105-227)||(2303570-2303692)
chr2 (282-328)||(2321428-2321474)
chr2 (105-157)||(2321272-2321324)
chr2 (282-328)||(2294113-2294159)
chr2 (282-328)||(2310444-2310490)
chr2 (282-328)||(2327281-2327327)
[»] chr5 (2 HSPs)
chr5 (282-335)||(15176349-15176402)
chr5 (3-70)||(15176593-15176660)
[»] chr4 (1 HSPs)
chr4 (282-328)||(55017087-55017133)


Alignment Details
Target: chr8 (Bit Score: 323; Significance: 0; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 26494612 - 26494946
Alignment:
1 tgagagaggaagatttgtagaaattgccatatttgaaggctgtgattttggaagggttaaggcgtcatcctccaactcactacacaattccacgtgtagt 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
26494612 tgagagaggaagatttggagaaattgccatatttgaaggctgtgattttggaagggttaaggcgtcatcctcctactcactacacaattccacgtgtagt 26494711  T
101 gacggaggatattgttttgaatggttacttggtgcctaaaaatgggactgtgaattttatggtggcagatataggattaaatccaacggtttgggaggat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
26494712 gacggaggatattgttttgaatggttacttggtgcctaaaaatgggactgtgaattttatggtggcagatataggattagatccaacggtttgggaggat 26494811  T
201 cctacggtgtttaagccagagaggtttctaaaagatgcaaaaaatagaaacgaatttgacgcatttgatgttaggggtataaaagagataaagatgatgc 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26494812 cctacggtgtttaagccagagaggtttctaaaagatgcaaaaaatagaaacgaatttgacgcatttgatgttaggggtataaaagagataaagatgatgc 26494911  T
301 cgtttggagcagggaggaggatttgtcctgcctat 335  Q
    |||||||||||||||||||||||||||||||||||    
26494912 cgtttggagcagggaggaggatttgtcctgcctat 26494946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 5 - 169
Target Start/End: Original strand, 26506661 - 26506825
Alignment:
5 agaggaagatttgtagaaattgccatatttgaaggctgtgattttggaagggttaaggcgtcatcctccaactcactacacaattccacgtgtagtgacg 104  Q
    ||||||||||||| | || || || ||| | ||||| |||||||| |||||||||||||| || |||||  ||||||||  |||||||| || ||||||     
26506661 agaggaagatttggaaaagttaccttatcttaaggcagtgattttagaagggttaaggcgccaccctccttctcactacttaattccacatgcagtgacc 26506760  T
105 gaggatattgttttgaatggttacttggtgcctaaaaatgggactgtgaattttatggtggcaga 169  Q
    |||||| |  |||| || |||||||||||||||||||||||||| || |||||||||||||||||    
26506761 gaggatgtgatttttaacggttacttggtgcctaaaaatgggacagttaattttatggtggcaga 26506825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 263 - 335
Target Start/End: Original strand, 26506901 - 26506973
Alignment:
263 atttgatgttaggggtataaaagagataaagatgatgccgtttggagcagggaggaggatttgtcctgcctat 335  Q
    |||||||||||  |||  ||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||    
26506901 atttgatgttacaggtcaaaatgagataaagatgatgccatttggagcaggaaggaggatttgtcctgcctat 26506973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 330
Target Start/End: Original strand, 41127308 - 41127356
Alignment:
282 aaagagataaagatgatgccgtttggagcagggaggaggatttgtcctg 330  Q
    ||||||||||||||||||||||||||||  |||||||| ||||||||||    
41127308 aaagagataaagatgatgccgtttggagttgggaggagaatttgtcctg 41127356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 10)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 114 - 227
Target Start/End: Original strand, 2327134 - 2327247
Alignment:
114 gttttgaatggttacttggtgcctaaaaatgggactgtgaattttatggtggcagatataggattaaatccaacggtttgggaggatcctacggtgttta 213  Q
    |||||||||||||| |||||||||||||||||||| |||||||| ||||||||||| || || ||  ||||    |||||||||||||| | || |||||    
2327134 gttttgaatggttatttggtgcctaaaaatgggacggtgaatttcatggtggcagagatggggttggatcctcgtgtttgggaggatccaatggagttta 2327233  T
214 agccagagaggttt 227  Q
    ||||||| ||||||    
2327234 agccagaaaggttt 2327247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 105 - 169
Target Start/End: Original strand, 2330840 - 2330904
Alignment:
105 gaggatattgttttgaatggttacttggtgcctaaaaatgggactgtgaattttatggtggcaga 169  Q
    |||||| | |||||||||||||| |||||||||||| ||||||| |||||||||||||| |||||    
2330840 gaggatgtggttttgaatggttatttggtgcctaaagatgggacggtgaattttatggttgcaga 2330904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 227
Target Start/End: Original strand, 2351164 - 2351268
Alignment:
123 ggttacttggtgcctaaaaatgggactgtgaattttatggtggcagatataggattaaatccaacggtttgggaggatcctacggtgtttaagccagaga 222  Q
    ||||| |||||||||||||||||||| || ||||||||||||||||| || || |   ||||    |||||||||||||| | || ||||||||||||||    
2351164 ggttatttggtgcctaaaaatgggacggtcaattttatggtggcagagatggggtgggatcctcgtgtttgggaggatccaatggagtttaagccagaga 2351263  T
223 ggttt 227  Q
    |||||    
2351264 ggttt 2351268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 330
Target Start/End: Original strand, 2330996 - 2331044
Alignment:
282 aaagagataaagatgatgccgtttggagcagggaggaggatttgtcctg 330  Q
    |||||||||||||||||||| |||||||| |||||||| ||||||||||    
2330996 aaagagataaagatgatgccatttggagctgggaggagaatttgtcctg 2331044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 105 - 227
Target Start/End: Original strand, 2303570 - 2303692
Alignment:
105 gaggatattgttttgaatggttacttggtgcctaaaaatgggactgtgaattttatggtggcagatataggattaaatccaacggtttgggaggatccta 204  Q
    |||||| | |||||||| ||||| |||||||||||||||||||| |||||||| ||| |||| || || || |   ||||    |||||||||||||| |    
2303570 gaggatgtggttttgaacggttatttggtgcctaaaaatgggacggtgaatttcatgctggcggagatggggtgggatcctcgtgtttgggaggatccaa 2303669  T
205 cggtgtttaagccagagaggttt 227  Q
     || |||||||||||| ||||||    
2303670 tggagtttaagccagaaaggttt 2303692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 328
Target Start/End: Original strand, 2321428 - 2321474
Alignment:
282 aaagagataaagatgatgccgtttggagcagggaggaggatttgtcc 328  Q
    ||||||||||||||||||||||||||||| || ||||| ||||||||    
2321428 aaagagataaagatgatgccgtttggagctggaaggagaatttgtcc 2321474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 105 - 157
Target Start/End: Original strand, 2321272 - 2321324
Alignment:
105 gaggatattgttttgaatggttacttggtgcctaaaaatgggactgtgaattt 157  Q
    |||||| | |||||||| ||||| |||||||||||||||||||| ||||||||    
2321272 gaggatgtggttttgaacggttatttggtgcctaaaaatgggacggtgaattt 2321324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 328
Target Start/End: Original strand, 2294113 - 2294159
Alignment:
282 aaagagataaagatgatgccgtttggagcagggaggaggatttgtcc 328  Q
    ||||||||||||||||||||||||||||| || || || ||||||||    
2294113 aaagagataaagatgatgccgtttggagctggaagaagaatttgtcc 2294159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 328
Target Start/End: Original strand, 2310444 - 2310490
Alignment:
282 aaagagataaagatgatgccgtttggagcagggaggaggatttgtcc 328  Q
    ||||||||||||||||||||||||||||| || || || ||||||||    
2310444 aaagagataaagatgatgccgtttggagctggaagaagaatttgtcc 2310490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 328
Target Start/End: Original strand, 2327281 - 2327327
Alignment:
282 aaagagataaagatgatgccgtttggagcagggaggaggatttgtcc 328  Q
    |||||||| |||||||||||||||||||| || ||||| ||||||||    
2327281 aaagagatcaagatgatgccgtttggagctggtaggagaatttgtcc 2327327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 282 - 335
Target Start/End: Complemental strand, 15176402 - 15176349
Alignment:
282 aaagagataaagatgatgccgtttggagcagggaggaggatttgtcctgcctat 335  Q
    |||||||||||||||||||| ||||||||||||||||| || ||||||| ||||    
15176402 aaagagataaagatgatgccatttggagcagggaggagaatgtgtcctggctat 15176349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 3 - 70
Target Start/End: Complemental strand, 15176660 - 15176593
Alignment:
3 agagaggaagatttgtagaaattgccatatttgaaggctgtgattttggaagggttaaggcgtcatcc 70  Q
    ||||| ||||||||| | ||| |||||||| | || ||||| |||||||||||| |||||||||||||    
15176660 agagaagaagatttgaaaaaaatgccatatcttaaagctgtaattttggaagggctaaggcgtcatcc 15176593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 328
Target Start/End: Original strand, 55017087 - 55017133
Alignment:
282 aaagagataaagatgatgccgtttggagcagggaggaggatttgtcc 328  Q
    |||||||| ||||||||||||||||| || |||||||||||||||||    
55017087 aaagagatgaagatgatgccgtttggtgctgggaggaggatttgtcc 55017133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University