View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1466_high_17 (Length: 313)
Name: NF1466_high_17
Description: NF1466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1466_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 19 - 304
Target Start/End: Complemental strand, 33264989 - 33264704
Alignment:
| Q |
19 |
gagatgtgggtccaagggccaatcagaactcctatgataaaccgcattttcatattcttccctaaaattcaaaattgtgatatgttatcattttgtctat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33264989 |
gagatgtgggtccaagggccaatcagaactcctatgataaaccgcattttcatattcttccctaaaattcaaaattgtgatatgttatcattttgtctat |
33264890 |
T |
|
| Q |
119 |
attaaattgcgagagtttaacacaaaaagatatggtaataaaaatcacctgctctcaacattagagtcaacttggatgccatttagatcttcttcattca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33264889 |
attaaattgcgagagtttaacacaaaaagatatggtaataaaaatcacctgctctcaacattagagtcaacttggatgccatttagatcttcttcattca |
33264790 |
T |
|
| Q |
219 |
tattttcacaattcatttcttcttcttgaggtgtagaagatgctccagcattccctgctccaaaagaactctctccggtcctttgc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
33264789 |
tattttcacaattcatttcttcttcttgaggtttagaagatgctccagcattccctgctccaaaacaactctctccggtcttttgc |
33264704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University