View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1466_high_38 (Length: 230)
Name: NF1466_high_38
Description: NF1466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1466_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 12 - 106
Target Start/End: Original strand, 49764377 - 49764471
Alignment:
| Q |
12 |
aaaactaagggtaattggtgttttatattgcatctccgtttatttttagttgtcgtgtctaagtttaatcatttacagatatccataaaattaat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49764377 |
aaaactaagggtaattggtgttttatattgcatctccgtttatttttagttgtcgtgtctaagtttaatcatttacagatatccaaaaaattaat |
49764471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University