View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1466_high_38 (Length: 230)

Name: NF1466_high_38
Description: NF1466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1466_high_38
NF1466_high_38
[»] chr1 (1 HSPs)
chr1 (12-106)||(49764377-49764471)


Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 12 - 106
Target Start/End: Original strand, 49764377 - 49764471
Alignment:
12 aaaactaagggtaattggtgttttatattgcatctccgtttatttttagttgtcgtgtctaagtttaatcatttacagatatccataaaattaat 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
49764377 aaaactaagggtaattggtgttttatattgcatctccgtttatttttagttgtcgtgtctaagtttaatcatttacagatatccaaaaaattaat 49764471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University