View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1466_low_23 (Length: 277)
Name: NF1466_low_23
Description: NF1466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1466_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 144 - 263
Target Start/End: Original strand, 34083794 - 34083913
Alignment:
| Q |
144 |
cctctggaatctggatgaggccttcaacaattctctatattcctctttttgtttgtatataaaccatctctaaaaacaaacaagagaagaccctgtcatg |
243 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||| ||||||| || |
|
|
| T |
34083794 |
cctctggaatctggatgagaccttcaacaattctctatattcctcttttcgtttgtatacaactcatctctaaaaacaaacaagagaaggccctgtcgtg |
34083893 |
T |
 |
| Q |
244 |
ctgcattggttagtcacagg |
263 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34083894 |
ctgcattggttagtcacagg |
34083913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 77 - 145
Target Start/End: Original strand, 34083688 - 34083756
Alignment:
| Q |
77 |
aataacaagttgtttcaactgagaatttagagcagtactgacatttatttacaacaacccataaactcc |
145 |
Q |
| |
|
|||||| || |||||||||||||||||||||| || ||||||||| |||| | ||||||||||||||| |
|
|
| T |
34083688 |
aataacgagctgtttcaactgagaatttagaggagcactgacattcatttttagcaacccataaactcc |
34083756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University